                                                                        Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:206 nt.     Distance to run of Ts=2 nt.   Size=36 nt.     Delta G= -9.10 kcal/mol
Antiterminator: Size=47 nt.     Delta G=-12.80 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G=-14.02 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCGAAGTGCTGGTGCATATCCAGGGGGAATAAaagggacgaaaccgcagggtcgctcaggatatgaagaattgggc
tgaagcccggattttttagcagatgcttgaccccggactaaagtccagggcaattgtcacgggcttattgaccaagtcccctcttctcaacgagccgctt
ttccattcagtcggtttttttaaccagacggacattcgacctcttacatgtaccctattgccccggttttcaaaccggggttaattttcccccatctctc
cactcggcttcagcccaatatcttGTG

    CT0338 --- dxs Gene: CT0338     GI: 21673177     BI number: CT0338     GOG: -------     Description: hypothetical protein Gene: dxs     GI: 21673176     BI number: CT0337     GOG: COG1154     Description: 1-deoxyxylulose-5-phosphate synthas tc t  a cg gc gc |  c |  a        g |  a      c  a |  t      a  a |  a      g  a |  t       gc         g |  c       gc       t  a c  t      a  g      a  a t  t      a  c      t  g cG       A  a      a  a aT       A  g      g  a cG       T  g       gt c  T      A  g       at t  A       At        cg c  T       Gc        tg t  C      G  g       cg c  C       Gc        gc t  A       Gt       |  t a  |       Gc       |  g cG       A  a      |  a cG        Cg       c  a cG        Cg        tg cG        Ta        gc cG        At        gc tA        Ta        gc                         ggattttttagcagatgcttgaccccggactaaagtccagggcaattgtcacgggcttattgaccaagtcccctcttctcaacgagccgcttttccattcagtcggtttttttaaccagacggacattcgacctcttacatgtaccctattgccccggttttcaaaccggggttaattttcccccatctctccactcggcttcagcccaatatcttGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [HI] COG1154 Deoxyxylulose-5-phosphate synthase ... can be seen here     ..................................................................................................................