                                                                        Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:47 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-15.20 kcal/mol
Antiterminator: Size=39 nt.     Delta G=-10.50 kcal/mol
Anti-antiterminator:   Size=59 nt.     Delta G=-18.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AACGATGGCATCGTGGTGCTTGGCGAGAAGAGTGTGAAGGTCACCGAGATCGGCGTGC
CCTTCCTCCGCAACGTCTGCATGGCGTTCGACGCGCACCTCTGGCGCTCCGACAGCCT
CTCCAAGGCCTACAACGTGTCGCGCGACATCCAGAAGGAGTACATCGAAAAGGCCCGC
CAGGCCAAGCTCCAGCAGACCTCCTGAgcgggtgtctcttaacggttttgaggggtgatcgtttggtcaccctttttttt
ggttaagatttcgtatgaaccgcacgatgacaaagtcaatcacacgATG

    CT0373 Gene: CT0373     GI: 21673212     BI number: CT0373     GOG: COG0673     Description: oxidoreductase, Gfo/Idh/MocA famil CC T  A CG GC |  A |  G A  A A  C C  C C  T GC GC AT CG         g |  A      g  t Cg       c  t Gc        at Cg        at Cg        tg Cg        ta Gt        cg        tt |  g       tg       g  t |  t       cg        cg |  c       tg        tg |  t      g  t       at Gc       t  g       gc At       g  a       ta At        gt        gc A  a       gc        gc A  a       cg        gc Gc        gt        gt Cg        At        at Tg        Gt        gt                         tttttggttaagatttcgtatgaaccgcacgatgacaaagtcaatcacacgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0673 Predicted dehydrogenases and related proteins ... can be seen here     ..................................................................................................................