                                                                        Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:44 nt.     Distance to run of Ts=1 nt.   Size=32 nt.     Delta G=-12.70 kcal/mol
Antiterminator: Size=73 nt.     Delta G=-11.70 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G=-10.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTTGAGCTGGCCGCTGAGGAGGCGCAGCAGCGTGGATTTGCCAGTGCCGTTCAGGCCG
ACCAGCGAGGCGCGATCCTTGTCGCCGATCCGGAATGAGGTGTTGCGCAGGAGCACTT
TGGTGCCTGCTGAAAGAGAGAGATTTCGTACTTCGAGCATggagtcgcggtttcaggtttgcagttgaag
atacgatatttcattaaagcgccatgccctctaaggattccggttatgtggccggtctttggctgtttttcccatggtcgctggaaacaggaggttgcag
cgtcaaacccgtgaGTG

    CT0376 --- CT0377 --- CT0378 Gene: CT0376     GI: 21673215     BI number: CT0376     GOG: COG1538     Description: FusA/NodT family protein Gene: CT0377     GI: 21673216     BI number: CT0377     GOG: COG0845     Description: conserved hypothetical protein Gene: CT0378     GI: 21673217     BI number: CT0378     GOG: COG0577,COG1136     Description: ABC transporter, ATP-binding protei            cg           a  a           t  t           a  a            gt            at            at            gc            ta           |  t           |  t           t  a           g  a           a  a            cg            gc           t  |           t  | gc        tg c  g       gc t  g       gc gt       a  a at       c  t gt       t  | gc       t  | Ta        tg        tg A  g       gc       a  t Cg        gc        tg Gt       |  c       tg At       |  t       gc Gt       |  c       gc Cg       |  t       cg T  c      |  a       cg Ta       c  a      t  | Cg       g  g      t  | At        cg        at T  |       ta        gc Gt        gt        gt Cg        at        at Ta        gc        at Ta        gc        tg Tg        Tg        cg                         ctgtttttcccatggtcgctggaaacaggaggttgcagcgtcaaacccgtgaGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [MU] COG1538 Outer membrane protein ... can be seen here [M] COG0845 Membrane-fusion protein ... can be seen here [V] COG0577 ABC-type antimicrobial peptide transport system, permease component ... can be seen here [V] COG1136 ABC-type antimicrobial peptide transport system, ATPase component ... can be seen here     ..................................................................................................................