                                                                        Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:88 nt.     Distance to run of Ts=2 nt.   Size=30 nt.     Delta G=-17.20 kcal/mol
Antiterminator: Size=36 nt.     Delta G=-12.50 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G=-19.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCCAGCCGTTGCAGGACATGGTGATGGATGTCGGCTCGTTGCTGGGGTCAAAGTGCAC
GACCAACTAAtcgtcaaatccgtaccaacgtgatcactatcgcttattataacaacatccacagttcggccatctggcatcagctggcggctg
tggttcgtgacgagggcatcgagctgctctctttcggcttcggcggagagcaggcttttgtcgagcgcctcgataacggctccatcgacctgctgctggt
caacgtgccgccggaagcgcccggtttgccggggctgcttccgaagatgATG

    CT0422 Gene: CT0422     GI: 21673261     BI number: CT0422     GOG: COG1429     Description: CobN protein, putativ ca g  t gc ta cg t  c at cg         a cg       g  c gc       t  g       tc g  |      g  a      t  g c  |       cg        cg tg        tg        gc tg        tg       g  | gc        gc       c  | at       |  a      t  | cg       g  t      t  | at       t  c       tg cg       g  g       cg cg        ta        ta t  t       cg        cg a  t       gc        ta c  c       gt        cg a  g       cg        gc at        gc        ta cg        gt        cg                         gcttttgtcgagcgcctcgataacggctccatcgacctgctgctggtcaacgtgccgccggaagcgcccggtttgccggggctgcttccgaagatgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG1429 Cobalamin biosynthesis protein CobN and related Mg-chelatases ... can be seen here     ..................................................................................................................