Gene putatively regulated by attenuation in C_tepidum_TLS
Characteristics of the secondary structures
Terminator: Distance from promoter:55 nt. Distance to gene:98 nt. Distance to run of Ts=0 nt. Size=35 nt. Delta G=-10.50 kcal/mol
Antiterminator: Distance from promoter:37 nt. Size=36 nt. Delta G=-11.80 kcal/mol
Anti-antiterminator: Distance from promoter:22 nt. Size=26 nt. Delta G= -7.10 kcal/mol
Nomenclature/Definitions
The most likely promoter is: ttgacg-catttt. It has a score value of 68.27 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
ttgacgtttaaaggttacgctgtcattttttaactttttgttatgagtgcccaggaattgtctcgaggcttcgcctgtaagaccggttcatgctggccag
ccaagaggcgcgtgtaatctttttttgtgttgcgctgaccgcgatgaggtttgcgggaaaaaactgacaatttcgattaactggttgactaaacttttta
acaaaacagacggaggaaacaaacATG
CT0425
Gene: CT0425 GI: 21673264 BI number: CT0425 GOG: ------- Description: hypothetical protei
g ca
c g c a
c t g g
at a a
gc cg
a a cg
cg at gc
t a tg g |
cg gc t |
tg t t cg
gc cg gc
t t cg tg
t t gc at
a c c c cg
a g t | | t
gc ta ta
gc cg ta
at gc gt
cg gc gc
tttttttgtgttgcgctgaccgcgatgaggtttgcgggaaaaaactgacaatttcgattaactggttgactaaactttttaacaaaacagacggaggaaacaaacATG
..................................................................................................................