                                                                        Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:55 nt.    Distance to gene:99 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-10.50 kcal/mol
Antiterminator:    Distance from promoter:37 nt. Size=36 nt.     Delta G=-11.80 kcal/mol
Anti-antiterminator:    Distance from promoter:19 nt.    Size=35 nt.     Delta G= -8.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgacg-catttt. It has a score value of 68.27 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgacgtttaaaggttacgctgtcattttTTAACTTTTTGTTATGAGTGTCCAGGAATTGTCTCGAGGCT
TCGCCTGTAAGACCGGTTCATGCTGGCCAGCCAAGAGGCGCGTGTAATCTTTTTTTTG
TGTTGCGCTGACCGCGATGAGGTTTGCGGGAAAAAGGCTGACAATTTCGATTAACTGG
TTGACTAAACTTTTTAACAAAACAAACGGAGGAAACAAacATG

    CT0428 Gene: CT0428     GI: 21673267     BI number: CT0428     GOG: -------     Description: hypothetical protei CG         G        CA T  A      C  G      C  A CG       C  T      G  G TG        AT       A  A GC        GC        CG T  T      A  A       CG T  T       AT        GC A  C       TG       G  | A  G       GC       T  | GC       T  T       CG GC        CG        GC AT        CG        TG CG        GC        AT |  T      C  C       CG |  A      T  |      |  T |  A       TA        TA CG        CG        TA TA        GC        GT GC        GC        GC                         TTTTTTTTGTGTTGCGCTGACCGCGATGAGGTTTGCGGGAAAAAGGCTGACAATTTCGATTAACTGGTTGACTAAACTTTTTAACAAAACAAACGGAGGAAACAAacATG     ..................................................................................................................