                                                                        Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:123 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-17.50 kcal/mol
Antiterminator: Size=80 nt.     Delta G=-28.81 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTTTTAACAAAACAAACGGAGGAAACAAacATGCTGAAAATGTATGTGGATTACTGGG
TTGCTGTATTAAGTGGATTTTTACAGCAGTATTTTGGCGTGAAATCGCAAAAAGGTGT
AACCATGATTGAGTATGCCTTGATTGCCGCCTTGATTGCTGTGGCGGTCATTGCGGTT
CTTTTGACTGTTGGATCGAACCTGAAGACCGTCTTCAGCTATGTCGGTAGCAATCTCA
CGACGTAAttggttgcccggccaggcacagacgcgtttactacgtaaaaactcttttacagattaacaGTG

    CT0429 Gene: CT0429     GI: 21673268     BI number: CT0429     GOG: COG3745     Description: conserved hypothetical protei GA T  T AT CG C  A A  G AT TA GT TG GC GC AT AT |  G A  A AT AT CG GC C  | T  | A  | A  | A  | G  | T  | GC CG GC        GT GC       T  G T  T       CG T  T       GC T  G       TG T  |       TG A  |       AT TA        GC GT        TA AT       T  T CG       C  T GC        CG AT        GC CG        CG AT        CG TG        GT             TCTTTTGACTGTTGGATCGAACCTGAAGACCGTCTTCAGCTATGTCGGTAGCAATCTCACGACGTAAttggttgcccggccaggcacagacgcgtttactacgtaaaaactcttttacagattaacaGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [U] COG3745 Flp pilus assembly protein CpaB ... can be seen here     ..................................................................................................................