                                                                        Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:73 nt.    Distance to gene:47 nt.     Distance to run of Ts=2 nt.   Size=25 nt.     Delta G= -7.60 kcal/mol
Antiterminator:    Distance from promoter:40 nt. Size=42 nt.     Delta G= -7.70 kcal/mol
Anti-antiterminator:    Distance from promoter:11 nt.    Size=46 nt.     Delta G=-14.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tcgaac-tataat. It has a score value of 66.27 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tcgaacgtaacaggcttatattatataatgtgaaacatttcgctgatcgtgcattgacatccgtttctatggaaaacgcgtcggcgtcacacccaattgt
ccgcttctccagtgtatgaggagatgccggtttttcaactacttctttccgtttcctgacgaggagcgggcaagaccaacgacaaggacaccactATG

    CT0467 Gene: CT0467     GI: 21673303     BI number: CT0467     GOG: COG1432,COG2267     Description: conserved hypothetical protei tc t  t ta gt         c cg       a  c cg       c  c ta       a  a a  a      c  a c  a      t  t a  a       gt g  |       cg t  |       gt t  |       gc a  |      c  |        t c  |      t  |      g  a gc        gc       t  t tg        cg       g  g gc        gc       a  a cg       c  |       cg t  |       at        cg at        at        ta gc       a  c       cg tg        at        ta cg        gc       t  t gc        gc        cg cg        ta        gc                         cggtttttcaactacttctttccgtttcctgacgaggagcgggcaagaccaacgacaaggacaccactATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG1432 Uncharacterized conserved protein ... can be seen here [I] COG2267 Lysophospholipase ... can be seen here     ..................................................................................................................