Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:161 nt.     Distance to run of Ts=2 nt.   Size=24 nt.     Delta G= -8.50 kcal/mol
Antiterminator: Size=46 nt.     Delta G=-11.50 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G=-16.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TATAGTGCTGGCGACCGCCCTCTTGCTAACGAGCGATTCGCGCCTGAAGGCGATTGTG
TCGATGGGCGTGCTCGGCTTTGGTGTTGGTATGATCTTCATCATCTACGGCGCGCCCG
ACGTGGCGCTGACCACTTTTGTTGCCATCGAGACGCTGAACGTCATTCTCTTTGTGCT
GGTGCTGGCCCATCTGCCGAAGTTCACCTCTCGTTCGCGCACCACCGGGCGGATTCGC
GCTGCTCAAACTCAGAACCGGTAAaacggattgttaggcggacaatcacaaatcataaggagataaacATG

    CT0485


Gene: CT0485     GI: 21673320     BI number: CT0485     GOG: -------     Description: hypothetical protei


           TT
          C  C
 AT        TA
G  G       AT
 CG        GC
 TG        TA
 GC        AT
 TG       |  C
 GT       T  T
T  G      G  A
T  C       GC
 AT        TG
 GC        TG        AC
 CG        GC       G  G
G  G       TG       C  T
 GC        GC        CG
 AT       G  G       CG
 AT       T  C       GC
 GT       T  |       CG
T  |      T  |       GC
 CG       C  |      |  T
 CG        GC       |  G
 GT        GC       C  A
 CG        CG        GC
 GT        TA        GC
                        ACTTTTGTTGCCATCGAGACGCTGAACGTCATTCTCTTTGTGCTGGTGCTGGCCCATCTGCCGAAGTTCACCTCTCGTTCGCGCACCACCGGGCGGATTCGCGCTGCTCAAACTCAGAACCGGTAAaacggattgttaggcggacaatcacaaatcataaggagataaacATG


    ..................................................................................................................