                                                                        Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:69 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-11.80 kcal/mol
Antiterminator: Size=38 nt.     Delta G= -8.30 kcal/mol
Anti-antiterminator:   Size=41 nt.     Delta G=-13.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCTCTTCGAGATCGGCGGCGTTTTTGACCAGGGTTTCGGGAATGAATTTGCCTCCGAA
GGTGCCGAAGTGGCCGAATTCATCGGGTGCGGAGTAGATAACCTTCTGCTTCATaaagcc
TTACAAAGTGTTAAAGATGGCGTTGCCGTTCTGTTGCGAGCTAAAGTGCGGCGACTTC
CTGTAGCTGTTGTGAATCTTTTTGCCCGTTGCCGGATGTCGGTGCAGGGTATTTGTTA
CAAAATATAGAAACCTTTCGATCAAttctccatctgccggagccattctctttccgtttccgcggcATG

    CT0523 Gene: CT0523     GI: 21673358     BI number: CT0523     GOG: COG1452     Description: hypothetical protei GA C  G       CT G  C      T  T T  T       AT T  A       AT G  A       GT TA        TG         T CG        GC       A  G T  T      T  C      G  T TG       T  C       GC GC       G  |       CG CG       T  |       CG CG        CG        GT GC        GT       T  G TG        AT       T  C TA        TG       G  A GC        GC        CG |  T      T  C       CG C  T       CG        CG GC        CG        GT GC        TA        TA                         TTTGTTACAAAATATAGAAACCTTTCGATCAAttctccatctgccggagccattctctttccgtttccgcggcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG1452 Organic solvent tolerance protein OstA ... can be seen here     ..................................................................................................................