                                                                        Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:0 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G= -9.10 kcal/mol
Antiterminator: Size=32 nt.     Delta G= -4.50 kcal/mol
Anti-antiterminator:   Size=31 nt.     Delta G= -3.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGTTGAGCAGCTGGATGAAGGTCCGGACATCCTTGAGATCCGGGGTGCGATCAATGGC
GAAGGTGCCATCAGGTGTCAACAGTGTTGCTGCGATGATTGGCAGCGCGGAATTTTTC
GATCCTGAGGCGGGGATGGTGCCGCAAATCTGTTTTCCGCCCCGGATGACAAGCTTGT
CCATtcgattcaagggttacatgcaaaaaggcctatttaaTTATTTCAGGCTCAGAAAAACAAATTTTATTTT
AAAGCCACTTTTTATCTGAACCTGCAAACTGGCTCGTCCATTGTGCCGGTTTTTTG

    CT0557 --- CT0558 --- CT0559 --- nadE Gene: CT0557     GI: 21673392     BI number: CT0557     GOG: -------     Description: hypothetical protein Gene: CT0558     GI: 21673393     BI number: CT0558     GOG: COG4942     Description: zinc metalloendopeptidase Gene: CT0559     GI: 21673394     BI number: CT0559     GOG: -------     Description: hypothetical protein Gene: nadE     GI: 21673395     BI number: CT0560     GOG: COG0171     Description: NH(3)-dependent NAD+ synthetas   A        GA A  T      T  A A  T      C  C C  T      T  C A  T       AT         C A  A       TG       C  A AT       T  C      T  T AT        TA        GT AT        TA        CG GT        TA       T  T A  A      C  C       CG C  A       AT        GC TA        CG        GC CG        CG        TG GC        GC        CG GC        AT        AT                         TTTTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [D] COG4942 Membrane-bound metallopeptidase ... can be seen here [H] COG0171 NAD synthase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_tepidum_TLS                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:150 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G= -6.10 kcal/mol Antiterminator: Size=16 nt.     Delta G= -3.30 kcal/mol Anti-antiterminator:   Size=56 nt.     Delta G=-15.50 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case AGTTGAGCAGCTGGATGAAGGTCCGGACATCCTTGAGATCCGGGGTGCGATCAATGGC GAAGGTGCCATCAGGTGTCAACAGTGTTGCTGCGATGATTGGCAGCGCGGAATTTTTC GATCCTGAGGCGGGGATGGTGCCGCAAATCTGTTTTCCGCCCCGGATGACAAGCTTGT CCATtcgattcaagggttacatgcaaaaaggcctatttaaTTATTTCAGGCTCAGAAAAACAAATTTTATTTT AAAGCCACTTTTTATCTGAACCTGCAAACTGGCTCGTCCATTGTGCCGGTTTTTTG     CT0557 --- CT0558 --- CT0559 --- nadE Gene: CT0557     GI: 21673392     BI number: CT0557     GOG: -------     Description: hypothetical protein Gene: CT0558     GI: 21673393     BI number: CT0558     GOG: COG4942     Description: zinc metalloendopeptidase Gene: CT0559     GI: 21673394     BI number: CT0559     GOG: -------     Description: hypothetical protein Gene: nadE     GI: 21673395     BI number: CT0560     GOG: COG0171     Description: NH(3)-dependent NAD+ synthetas GA T  T A  T G  G CG GC TA CG GC TG |  C |  G T  G G  A TA GT AT C  T                 TG AT                 A  G AT                 G  T |  C                G  G CG                  GC TA        GG        GC GT       A  C       CG T  |      G  G       GC GC        TG       |  A GC        CG       |  A AT        CG       G  A CG        TA        AT TA        AT        GC                         TGTTTTCCGCCCCGGATGACAAGCTTGTCCATtcgattcaagggttacatgcaaaaaggcctatttaaTTATTTCAGGCTCAGAAAAACAAATTTTATTTTAAAGCCACTTTTTATCTGAACCTGCAAACTGGCTCGTCCATTGTGCCGGTTTTTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [D] COG4942 Membrane-bound metallopeptidase ... can be seen here [H] COG0171 NAD synthase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_tepidum_TLS                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:186 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G= -9.70 kcal/mol Antiterminator: Size=47 nt.     Delta G= -8.70 kcal/mol Anti-antiterminator:   Size=16 nt.     Delta G= -5.50 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case AGTTGAGCAGCTGGATGAAGGTCCGGACATCCTTGAGATCCGGGGTGCGATCAATGGC GAAGGTGCCATCAGGTGTCAACAGTGTTGCTGCGATGATTGGCAGCGCGGAATTTTTC GATCCTGAGGCGGGGATGGTGCCGCAAATCTGTTTTCCGCCCCGGATGACAAGCTTGT CCATtcgattcaagggttacatgcaaaaaggcctatttaaTTATTTCAGGCTCAGAAAAACAAATTTTATTTT AAAGCCACTTTTTATCTGAACCTGCAAACTGGCTCGTCCATTGTGCCGGTTTTTTG     CT0557 --- CT0558 --- CT0559 --- nadE Gene: CT0557     GI: 21673392     BI number: CT0557     GOG: -------     Description: hypothetical protein Gene: CT0558     GI: 21673393     BI number: CT0558     GOG: COG4942     Description: zinc metalloendopeptidase Gene: CT0559     GI: 21673394     BI number: CT0559     GOG: -------     Description: hypothetical protein Gene: nadE     GI: 21673395     BI number: CT0560     GOG: COG0171     Description: NH(3)-dependent NAD+ synthetas            TC           A  A            CG            CG           G  T           T  G            GT            GC         T           A  A      A  G           A  A      G  A           G  |      C  T           C  |      G  T           G  |       TG            GC        CG            TA        GC           A  G       TA           A  T       TG           C  |       GC AG        TG        TG A  G       AT        GC GT        GT       A  G CG        CG       C  | GC        GC       A  | GC       |  T      A  | TA        TG        CG AT        GC        TA                         ATTTTTCGATCCTGAGGCGGGGATGGTGCCGCAAATCTGTTTTCCGCCCCGGATGACAAGCTTGTCCATtcgattcaagggttacatgcaaaaaggcctatttaaTTATTTCAGGCTCAGAAAAACAAATTTTATTTTAAAGCCACTTTTTATCTGAACCTGCAAACTGGCTCGTCCATTGTGCCGGTTTTTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [D] COG4942 Membrane-bound metallopeptidase ... can be seen here [H] COG0171 NAD synthase ... can be seen here     ..................................................................................................................