                                                                        Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:53 nt.     Distance to run of Ts=2 nt.   Size=32 nt.     Delta G= -8.90 kcal/mol
Antiterminator: Size=35 nt.     Delta G= -8.90 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G= -7.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACCGTGGAGTTCGAGGAGGCTACGATGCCGGTGGTCGAGCTGCTCATGGCGCTTGCGG
CATTCCCGTCCAAAAACGAAGCACGGCGCATGATTCAGCAGGGCGCGGTGCAGGCTGG
CAACGAGAAAATTTCTGATATCAATGCCGTTATCGAGCTGACCGAAAACCCCGTCATC
ATCCGCGCAGGCAAACGAAAATTTTTCAAGGTGGCGCGCGCAAAAAAATCGTTTTGAa
tgcgtttgctttttcctataattgcaccaactgacgcctttctctaacctctatccggagctaccaccTTG

    CT0562 Gene: CT0562     GI: 21673397     BI number: CT0562     GOG: COG1945     Description: conserved hypothetical protei AA A  C A  C G  C C  C CG         T AT       A  T GC        AT TA        AT        AT |  T       AT       A  C C  C       GC       A  G G  A      C  A       AT AT       A  A       AT GC       A  G       AT C  C      A  |       AT T  G       CG        CG A  C       GT       G  A T  G      G  G      C  a T  C      A  |       Gt G  A       CG        Cg CG        GC        Gc CG        CG        Cg GC        GC        Gt TA        CG        Gt                         tgctttttcctataattgcaccaactgacgcctttctctaacctctatccggagctaccaccTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG1945 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................