                                                                        Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:170 nt.     Distance to run of Ts=3 nt.   Size=35 nt.     Delta G=-15.20 kcal/mol
Antiterminator: Size=24 nt.     Delta G=-12.00 kcal/mol
Anti-antiterminator:   Size=44 nt.     Delta G=-16.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTTCTTCAATATCGAGAAACTGTGCTCGCCCCTCGGCGATGCGCTCTTCCCGAACCTG
CAAGACGTCTGCGTGCCAGGCTGGTGAGGGAATGTTCGCCGGCGTACTGGCGAGGTCT
GCCCAGATTTCTTCAATCGCTTGCAGCTTCTCTTCGACGCTCATTTGTTTCAATGGAA
TGCTCAGGTGCATgggatttctccggatggttcttcagcgcataataaggaaaagaacaaaattcagggaagatcgggataacgtacgtcg
gcggagccacttaccatgtcactttcgatgatggtTTG

    CT0582 Gene: CT0582     GI: 21673417     BI number: CT0582     GOG: -------     Description: conserved hypothetical protei CT T  G GC CG AT |  G                 GT |  C                C  A G  C                 GC A  A                 GT A  G                 CG CG                  CG GC        AA        GC T  T      G  T       CG CG       G  G       TA CG        GT        TG AT        AT       |  G A  G       GC       G  T G  A       TG       T  C CG        GC       A  T CG        GC       A  G CG        TG        GC TA        CG        GC TA        GC        GC                         AGATTTCTTCAATCGCTTGCAGCTTCTCTTCGACGCTCATTTGTTTCAATGGAATGCTCAGGTGCATgggatttctccggatggttcttcagcgcataataaggaaaagaacaaaattcagggaagatcgggataacgtacgtcggcggagccacttaccatgtcactttcgatgatggtTTG     ..................................................................................................................