                                                                        Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:95 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-17.90 kcal/mol
Antiterminator: Size=38 nt.     Delta G= -7.20 kcal/mol
Anti-antiterminator:   Size=28 nt.     Delta G= -5.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GATCGTAGTGGTGACCGTGGATTCGGCGGCGACAAGAAGAAGAGCTTCGGCAAGCCCT
CGGGCGGAGGCAAGCGCAAAAAAGATGATGGTGCGTTCTTCACCGGTTTTACCGGCAC
CAAAAAGAAGCGCATGAAGGACTGAgcgttttcttcagctcacgatttgaaagagcctgacgcgatgagtcctgccgcgtcg
ggctcttttgcttttcaccccacagcgcatacattttaatcataagtacttttcgcatccagtctgccggtgatccggttcacgaaaacagggagttgcg
atATG

   ف --- CT0598 Gene: CT0598     GI: 21673433     BI number: CT0598     GOG: COG1236     Description: metallo-beta-lactamase superfamily protein Gene: CT0599     GI: 21673434     BI number: CT0599     GOG: NOG26822     Description: hypothetical protei             t           t  t           a  g           g  a           c  a           a  a            cg         t   g        ta       g  c A  c       cg       a  c G  g       gc       g  t T  t      a  c      t  g C  t      c  t      a  c At       t  |       gc Gt       t  |       cg Gc       c  |       gc At       t  |       cg At       t  |       at Gc        tg        gc Ta        ta        tg A  |       gc        cg Cg        cg        cg Gc        gc        gc                         tcttttgcttttcaccccacagcgcatacattttaatcataagtacttttcgcatccagtctgccggtgatccggttcacgaaaacagggagttgcgatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG1236 Predicted exonuclease of the beta-lactamase fold involved in RNA processing ... can be seen here     ..................................................................................................................