                                                                        Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:53 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G= -8.60 kcal/mol
Antiterminator: Size=74 nt.     Delta G=-15.80 kcal/mol
Anti-antiterminator:   Size=37 nt.     Delta G= -7.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATCATATTCCACGTCAGCATCCTGATTGAGGACCTTGAAGCTCTGATCAGAGATGATC
GACGAAAAATGGACAAAGATGTCTTCCCCGCCATCAGGGTTCAGAATAAAACCGTACC
CTTTTTTGCCATCAAACCATTTGACTTTACTTTTAGCCATgatgacgacattcgatggttaatgttaaca
aaataaaaacatcagtttattgtttaatatagattattgcgtcatataacgcaataatattttcgctttaaacacaccaaatacaaaacatataatttaa
ttctcaaattagtcATG

    CT0609 --- CT0608 --- CT0607 --- serS Gene: CT0609     GI: 21673444     BI number: CT0609     GOG: COG1028     Description: sepiapterin reductase Gene: CT0608     GI: 21673443     BI number: CT0608     GOG: -------     Description: hypothetical protein Gene: CT0607     GI: 21673442     BI number: CT0607     GOG: COG1610     Description: conserved hypothetical protein Gene: serS     GI: 21673441     BI number: CT0606     GOG: COG0172     Description: seryl-tRNA synthetas            at           c  c           a  a           a  g            at            at            at            ta            at            at           a  g           a  t           c  |            at            at            ta            ta            gt            ta            at cg       a  a a  a       tg gc        ta ta        gt at        gt gt        ta |  c       at |  g       gt Ta        cg        ta At       t  |      a  t Cg       t  |      c  a Cg       a  |       ta Gt       c  |       gc At       a  |       cg Ta        gc        gc Ta        cg        ta T  t       at        ta T  |       gc        at Cg        ta        ta At        at        ta                         tattttcgctttaaacacaccaaatacaaaacatataatttaattctcaaattagtcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [IQR] COG1028 Dehydrogenases with different specificities (related to short-chain alcohol dehydrogenases) ... can be seen here [S] COG1610 Uncharacterized conserved protein ... can be seen here [J] COG0172 Seryl-tRNA synthetase ... can be seen here     ..................................................................................................................