                                                                        Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:73 nt.     Distance to run of Ts=1 nt.   Size=34 nt.     Delta G=-20.60 kcal/mol

                                                                        Nomenclature/Definitions

GTGGCGGCTGACATTTACGCGGCCATCGAAGGCGCGCTTGCTGCAGGCTTCCGCACGG
GCGACATCGCCGCAGCGGGCGAGGCGATCTCTTCGACAACAGAAATGACGGCGGCTAT
CGTCGCCCGAATTTGAcggcgaacaacgcaaagaaaacgacagagcacatgcggcggtgagccgcaacgagaaaagccggagctctgc
aggtctccggcttttcagtttttgacggggcctgctagcccggacaagaaaaaattcagacaagattatatatccgataacggaatctttgaaaccATG

    CT0613 --- 1 --- leuA Gene: CT0614     GI: 21673449     BI number: CT0614     GOG: COG0065     Description: 3-isopropylmalate dehydratase, large subunit, putative Gene: CT0613     GI: 21673448     BI number: CT0613     GOG: COG0066     Description: 3-isopropylmalate dehydratase, small subunit, putative Gene: leuA-1     GI: 21673447     BI number: CT0612     GOG: COG0119     Description: 2-isopropylmalate synthas           gc          t  a           cg           tg          c  t           gc           at           gc           gc           cg           cg           gc           at           at           at           at           gc             agtttttgacggggcctgctagcccggacaagaaaaaattcagacaagattatatatccgataacggaatctttgaaaccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0065 3-isopropylmalate dehydratase large subunit ... can be seen here [E] COG0066 3-isopropylmalate dehydratase small subunit ... can be seen here [E] COG0119 Isopropylmalate/homocitrate/citramalate synthases ... can be seen here     ..................................................................................................................