                                                                        Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:87 nt.     Distance to run of Ts=0 nt.   Size=39 nt.     Delta G=-11.40 kcal/mol
Antiterminator: Size=46 nt.     Delta G= -9.60 kcal/mol
Anti-antiterminator:   Size=44 nt.     Delta G=-10.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AATACCTGAACAATTCCGTCAAAAACGCGCTTGCCAAATCGATGCCATTTCCCTCGCT
TCCCAGGGAATACGGTGCCAAAGGGATCTGGGTAGGGTTTGTTTTCACTCCCGAAGGT
GTCGGGCGCTGAacatctctgttgataggttgccttgtatcgcaaagttgttgtatactcagaaaggctgtccccctgacagttttgaggt
gttttttaccggtttgcatgattaaggccatgactgtgtcccgcccgaactgtttttacctgttacgaaaacataaattcatttccgactgatATG

    CT0636 Gene: CT0636     GI: 21673468     BI number: CT0636     GOG: COG0823     Description: TolB protein, putativ             t           g  t           a  g tg        at c  t       at t  t       cg cg        gt         c ta       c  |      c  c at        ta       c  t c  a       at        cg a  |       ta        ta A  |       gc        gc G  |      |  t       ta Tg       |  c       cg Cg       |  a       gt |  t      |  g       gt Gt       |  a       at Cg        ta        at Gc        ta       a  g Gc        cg       g  a Gt        cg       a  | C  t       gc       c  | T  g      |  t       tg Gt       t  g       cg Ta       t  t       at Gt        gc        tg Gc        gc        at                         tttttaccggtttgcatgattaaggccatgactgtgtcccgcccgaactgtttttacctgttacgaaaacataaattcatttccgactgatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [U] COG0823 Periplasmic component of the Tol biopolymer transport system ... can be seen here     ..................................................................................................................