                                                                        Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:27 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-14.90 kcal/mol
Antiterminator: Size=29 nt.     Delta G= -8.30 kcal/mol
Anti-antiterminator:   Size=57 nt.     Delta G= -7.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ggaaaaagcattgtcgttgaaggtcattgcgacgaacggggtacatcggagtacaacatggcacttggcgaacgtagggaATGCAAGTGCAA
GGTATGATGAGTTTTGGTGCCGATCAGGCACGAATGACCACTATCAGTTACAGTGAAG
AAAAACCGTTTGACCTTGGGCACGATGAAACAGCGGGGTCAAAGAACAGATGGGCGCA
TTTCGTGGAGAAGTAAatttgccatgaagatatggagggcataaaagctttccagtctttttttattccatcaacacaacgagagaat
acccATG

    CT0638 Gene: CT0638     GI: 21673470     BI number: CT0638     GOG: COG2885     Description: peptidoglycan-associated lipoprotei GA A  A A  C A  A CG TA GT |  G G  G G  G GC CG GC A  A                 aa C  T                t  a A  T                a  a A  |        A        cg A  |      T  A       gc G  |      G  a       gt T  |       At        gt AT        At        at GC       G  t       gc CG       A  g       gc AT        Gc        ta CG        Gc       a  | G  G       Ta        tg G  A       Gt        at G  G       Cg        gc TA        Ta        at TA        Ta        at CG        Tg        gt                         ttttattccatcaacacaacgagagaatacccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG2885 Outer membrane protein and related peptidoglycan-associated (lipo)proteins ... can be seen here     ..................................................................................................................