Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:188 nt.     Distance to run of Ts=1 nt.   Size=27 nt.     Delta G= -8.90 kcal/mol
Antiterminator: Size=29 nt.     Delta G= -5.80 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G= -5.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tgtaaaccttagttggttcaagttagcaaaaggtctgcaaataaaaaaagatttcatagcctcgctcacctcctttacgggaagttgtgtgtgatgattt
tccgacttttttcagatagtgcgcacttcccgtccttgcaatgctgtcgttaagggatgctgctcaaacacttaggcgttaatgttcattggttgagtat
atttacagcttgcctgatcgtttaagctataaaattttttatttgcagaccttttcctaaattaacccgattatcaaaatctctttaccgtataaatccc
ATG

    CT0642


Gene: CT0642     GI: 21673474     BI number: CT0642     GOG: NOG18209     Description: hypothetical protei


 aa
a  a
a  a
a  g
 ta
 at
 at
 at
c  |
 gc
 ta
|  t       ta
c  a      t  c        g
 tg        tg       t  t
 gc        cg       g  g
 gc        cg        ta
 at       |  a       gt
a  c       ta        tg
a  |       cg        ta
a  |      c  t       gt
 cg        at        at
 gc        cg        at
 at       t  t       gt
t  c       cg        gc
 ta        gt        gc
 gc        cg        cg
                        acttttttcagatagtgcgcacttcccgtccttgcaatgctgtcgttaagggatgctgctcaaacacttaggcgttaatgttcattggttgagtatatttacagcttgcctgatcgtttaagctataaaattttttatttgcagaccttttcctaaattaacccgattatcaaaatctctttaccgtataaatcccATG
    ..................................................................................................................