                                                                        Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:91 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G= -9.26 kcal/mol
Antiterminator: Size=49 nt.     Delta G= -9.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAACGCTTCTACCGCGTGGACAAGGCGCGTTCGCGCGAACTTGGTGGCACGGGGCTTG
GTCTCTCCATCGTCAAGCATATCGTACTTGCACATAAAGGCAAGGTCGAGGTTCGCTC
CAGAATCAATCGTGGTACGACTTTCACCGTTACGCTTCCCGTCGCCGGAGCCTGAacgc
gaggctgttgaaacggctggaactggctattttttcggttaatcgccatttttttttgtcacataaccctacaggctatgaaaaaacgctgatcctcttg
aaccccgcaatagttcaattccgctATG

    CT0659 Gene: CT0659     GI: 21673491     BI number: CT0659     GOG: COG0668     Description: conserved hypothetical protei CG T  C GC CG CG |  A |  G |  C |  C       ga |  T      t  a CG        ta TA        gc Ta        tg |  c       cg Cg        gc Gc        gt Cg       a  g A  a      g  g T  g      c  a Tg       g  a Gc       c  c C  t      a  t Cg       A  | At       G  | |  t      T  | Cg        Cg Ta        Cg Ta        Gc             tattttttcggttaatcgccatttttttttgtcacataaccctacaggctatgaaaaaacgctgatcctcttgaaccccgcaatagttcaattccgctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG0668 Small-conductance mechanosensitive channel ... can be seen here     ..................................................................................................................