                                                                        Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:148 nt.     Distance to run of Ts=3 nt.   Size=33 nt.     Delta G=-10.10 kcal/mol
Antiterminator: Size=29 nt.     Delta G=-12.80 kcal/mol
Anti-antiterminator:   Size=46 nt.     Delta G=-13.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAGTCCGTCCAGAGAGGTATTGAGAGAATCAAGCGTATTCTCGACTGGCGCGGTGCAG
AGGTCCGCCAATCTTTGTTCATGCTCGTTCAAagtgttccgggcggatggtttcgcagaggaactgttttacggct
tttgtgagcagttctttcatcatggcacacccctctcattacacgccataaagtcgattgttccgagaggggagatctcattgggaccaataattcggtg
ggcaaggaaaactgctcaatcatgacgacgggacagaccgcctggcagatcccgcgcagggctttgGTG

    CT0667 Gene: CT0667     GI: 21673498     BI number: CT0667     GOG: -------     Description: hypothetical protei GC T  T A  C C  G T  T T  T GC TA                   t TA                 t  t Ta                 t  a Cg        gg        gc |  t      t  t       tg |  g       at        cg |  t       gt       a  | |  t       gc       a  | T  c       cg        gc A  c       gc        gt A  g      |  a       at Cg       g  g       gt Cg       g  a       at Gc        cg        cg Cg        cg        gt Cg        ta        cg Ta        ta        ta Gt        gc        tg                         cagttctttcatcatggcacacccctctcattacacgccataaagtcgattgttccgagaggggagatctcattgggaccaataattcggtgggcaaggaaaactgctcaatcatgacgacgggacagaccgcctggcagatcccgcgcagggctttgGTG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_tepidum_TLS                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:163 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-12.80 kcal/mol Antiterminator: Size=46 nt.     Delta G=-13.80 kcal/mol Anti-antiterminator:   Size=29 nt.     Delta G= -7.70 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CAGTCCGTCCAGAGAGGTATTGAGAGAATCAAGCGTATTCTCGACTGGCGCGGTGCAG AGGTCCGCCAATCTTTGTTCATGCTCGTTCAAagtgttccgggcggatggtttcgcagaggaactgttttacggct tttgtgagcagttctttcatcatggcacacccctctcattacacgccataaagtcgattgttccgagaggggagatctcattgggaccaataattcggtg ggcaaggaaaactgctcaatcatgacgacgggacagaccgcctggcagatcccgcgcagggctttgGTG     CT0667 Gene: CT0667     GI: 21673498     BI number: CT0667     GOG: -------     Description: hypothetical protei            GC           T  T           A  C           C  G           T  T           T  T            GC            TA            TA            Ta AG        Cg        gg C  A      |  t      t  t G  G      |  g       at T  G      |  t       gt GT       |  t       gc GC       T  c       cg C  |      A  c       gc GC       A  g      |  a CG        Cg       g  g GC        Cg       g  a GC        Gc        cg TA        Cg        cg C  A       Cg        ta AT        Ta        ta GC        Gt        gc                         tgttttacggcttttgtgagcagttctttcatcatggcacacccctctcattacacgccataaagtcgattgttccgagaggggagatctcattgggaccaataattcggtgggcaaggaaaactgctcaatcatgacgacgggacagaccgcctggcagatcccgcgcagggctttgGTG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_tepidum_TLS                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:174 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-12.80 kcal/mol Antiterminator: Size=46 nt.     Delta G=-13.80 kcal/mol Anti-antiterminator:   Size=29 nt.     Delta G= -7.70 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CAGTCCGTCCAGAGAGGTATTGAGAGAATCAAGCGTATTCTCGACTGGCGCGGTGCAG AGGTCCGCCAATCTTTGTTCATGCTCGTTCAAagtgttccgggcggatggtttcgcagaggaactgttttacggct tttgtgagcagttctttcatcatggcacacccctctcattacacgccataaagtcgattgttccgagaggggagatctcattgggaccaataattcggtg ggcaaggaaaactgctcaatcatgacgacgggacagaccgcctggcagatcccgcgcagggctttgGTG     CT0667 Gene: CT0667     GI: 21673498     BI number: CT0667     GOG: -------     Description: hypothetical protei            TG           A  C           C  T           T  C           T  G           G  T            TT            TC            TA            CA AG        Ta        gg C  A      |  g      t  t G  G      |  t       at T  G      |  g       gt GT       |  t       gc GC       A  t       cg C  |      A  c       gc GC       C  c      |  a CG        Cg       g  g GC        Gg       g  a GC        Cg        cg TA        Cc        cg C  A       Tg        ta AT        Gg        ta GC        Ga        gc                         tgttttacggcttttgtgagcagttctttcatcatggcacacccctctcattacacgccataaagtcgattgttccgagaggggagatctcattgggaccaataattcggtgggcaaggaaaactgctcaatcatgacgacgggacagaccgcctggcagatcccgcgcagggctttgGTG     ..................................................................................................................