                                                                        Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:40 nt.    Distance to gene:137 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-13.50 kcal/mol
Antiterminator:    Distance from promoter:26 nt. Size=28 nt.     Delta G= -4.10 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G=-12.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGGGG-taaact. It has a score value of 60.91 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGGGGTCAcactatagctccgataaacttcgcggttttgacgtgagttgagtatacacgctggttatcaagctctgtgctgttgcaggttcag
agctttttttgttaggttgcggcatctctgaacattgccggtcattcgattgcgcggcctcggctggcatgctggcgcatcggctctgcatcgttcctga
cgattttccgagatgcttttcatgaatgcattgcactaatacccgcccATG

    Arg --- 3 --- tRNA Gene: pheT     GI: 21673560     BI number: CT0730     GOG: COG0072,COG0073     Description: phenylalanyl-tRNA synthetase, beta subunit Gene: CT0731     GI: 21673561     BI number: CT0731     GOG: -------     Description: hypothetical protein Gene: CT0732     GI: 21673562     BI number: CT0732     GOG: -------     Description: conserved hypothetical protei tg g  a cg at g  t t  g ta tg |  t |  a |  t ta gc        tc        tg |  a      a  a      t  c gc        ta       g  a cg        tg        tg gc        gc        cg c  t       gt        gt t  |      |  c      t  t tg       t  t       gc cg        cg        ta a  |       gt        cg at        cg        ta at       |  c       cg ta        at        gc at        cg        at gc        at        at                         tttttgttaggttgcggcatctctgaacattgccggtcattcgattgcgcggcctcggctggcatgctggcgcatcggctctgcatcgttcctgacgattttccgagatgcttttcatgaatgcattgcactaatacccgcccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0072 Phenylalanyl-tRNA synthetase beta subunit ... can be seen here [R] COG0073 EMAP domain ... can be seen here     ..................................................................................................................