                                                                        Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:121 nt.     Distance to run of Ts=3 nt.   Size=21 nt.     Delta G= -8.70 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -6.00 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G=-10.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGATCGTTACCGATGCTTCCGGCAAGGTGCTCTATGCCGAGCAGGTACCCGAGATCGT
ACAGGAGCCGGATTACGACAAGGCTCTGGCTGCGCTCGCCTGAttgtctgctgacatttttctctctg
aagccatgccgtcgcgcgaccgcatggcttctgttttcctgcccgatttttcatttcagccacggtataacgcctgtgatttgagtggtattacgtctgt
acttcgtatctttttctcacattgtttccccttggtttttcgcgttcctcactcataacgcaaaccgcaaatccATG

    CT0755 Gene: CT0755     GI: 21673585     BI number: CT0755     GOG: COG0366     Description: alpha-amylas             t   G       c  c T  C      t  t CG        cg GC        ta GT        ta T  C       tg C  |      |  c T  |      |  c CG       |  a GC       |  t GC       t  g AT       t  c A  G      a  c C  A       cg        ga At        at       c  c Gt        gc        gc Cg       t  |       cg At        cg        gc T  c       gc       c  | T  t       tg        ta A  g      |  c       gt Gc        cg        cg Gt        ta        cg Cg        gc        gc                         ttctgttttcctgcccgatttttcatttcagccacggtataacgcctgtgatttgagtggtattacgtctgtacttcgtatctttttctcacattgtttccccttggtttttcgcgttcctcactcataacgcaaaccgcaaatccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG0366 Glycosidases ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_tepidum_TLS                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:139 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-21.40 kcal/mol Antiterminator: Size=48 nt.     Delta G= -5.73 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TGATCGTTACCGATGCTTCCGGCAAGGTGCTCTATGCCGAGCAGGTACCCGAGATCGT ACAGGAGCCGGATTACGACAAGGCTCTGGCTGCGCTCGCCTGAttgtctgctgacatttttctctctg aagccatgccgtcgcgcgaccgcatggcttctgttttcctgcccgatttttcatttcagccacggtataacgcctgtgatttgagtggtattacgtctgt acttcgtatctttttctcacattgtttccccttggtttttcgcgttcctcactcataacgcaaaccgcaaatccATG     CT0755 Gene: CT0755     GI: 21673585     BI number: CT0755     GOG: COG0366     Description: alpha-amylas   t t  c t  t t  c t  t a  c c  t a  g g  a ta        cg cg       g  c gc        cg |  c       ta t  a       gc c  t      c  c tg        cg gc        gc t  c       ta tg        at At        cg Gc        cg Tg        gc C  c       at Cg        at Gc        gc             tgttttcctgcccgatttttcatttcagccacggtataacgcctgtgatttgagtggtattacgtctgtacttcgtatctttttctcacattgtttccccttggtttttcgcgttcctcactcataacgcaaaccgcaaatccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG0366 Glycosidases ... can be seen here     ..................................................................................................................