                                                                        Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:101 nt.     Distance to run of Ts=1 nt.   Size=24 nt.     Delta G= -8.50 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -4.80 kcal/mol
Anti-antiterminator:   Size=41 nt.     Delta G= -3.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGCATAAAGCAGATGCTTCTGGATAATGCCCAGCCTGAACGTCAAAAACAGATGCGTC
CCGAACAACGCCACCAGCAGAGGGATGCCCCAGACAAGATCGCTGACTTGTGAAAGAA
GCGCTTCAAATGATTGCATgatttttggttaggatgaatgtggatggaaacctgggcgcgcggaaccccggctccgcttcttttga
aatcgtcaggaaaaagtacggaaattcccgaagctctggaactgccagcttgacagttccacacacatcgcgtatatttgaaaaacatacaaagcatcAT
G

    CT0821 --- CT0820 --- CT0819 Gene: CT0821     GI: 21673650     BI number: CT0821     GOG: COG2929     Description: conserved hypothetical protein Gene: CT0820     GI: 21673649     BI number: CT0820     GOG: -------     Description: conserved hypothetical protein Gene: CT0819     GI: 21673648     BI number: CT0819     GOG: -------     Description: hypothetical protei            aa   a       a  c g  t       gc T  t       gt A  t       tg C  t      a  g G  t      g  g Tg        gc Tg        tg At        gc Gt       t  g       ac Ta       a  |      a  c |  g      a  |       gc A  g       gc        gc A  a       tg        cg At       a  g      g  | Cg       g  |       cg Ta       g  |       gc Ta       a  |      c  | |  t       ta        gt Cg        ta        gc Gt        gc        gc Cg        gc        tg                         cttcttttgaaatcgtcaggaaaaagtacggaaattcccgaagctctggaactgccagcttgacagttccacacacatcgcgtatatttgaaaaacatacaaagcatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG2929 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................