                                                                        Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:48 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G= -9.50 kcal/mol
Antiterminator: Size=49 nt.     Delta G=-12.66 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

attacaagctgatcgaacagttaacgacttttcacagagaaacttgttgccggctcaggctcttccTTGCAGGAACGTCTGCCCTT
TAGCCACCGTGAACTTAAAAAAAACAAAGCCGGAAAGCCAGAAAGTTCACGGTTTCGC
AATCCGCTGGTTTCAGCGAAATTTGCCGATGCCGACGAGCCCTAAgcgtcacagaacgaaaaaccga
cacgggccgccggatgtggtttgaggtgtttttttcttattttgcgcaaagatagcacaggctaacccaaccttcaaggccatacctaaTTG

    CT0836 Gene: CT0836     GI: 21673665     BI number: CT0836     GOG: COG4886     Description: internalin-related protei   g c  a a  a a  a g  a a  a c  c a  c cg ta         g gc       g  a c  a      c  t g  c       cg A  |       gt A  |       cg T  |       cg Cg        gt Cg        gt Cg        gt Gc       |  g A  |      |  a Gc       |  g Cg        cg A  c       at Gc        cg Cg        at Cg        gt             tttttcttattttgcgcaaagatagcacaggctaacccaaccttcaaggccatacctaaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG4886 Leucine-rich repeat (LRR) protein ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_tepidum_TLS                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:55 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-10.10 kcal/mol Antiterminator: Size=49 nt.     Delta G=-12.66 kcal/mol Anti-antiterminator:   Size=69 nt.     Delta G=-20.10 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case attacaagctgatcgaacagttaacgacttttcacagagaaacttgttgccggctcaggctcttccTTGCAGGAACGTCTGCCCTT TAGCCACCGTGAACTTAAAAAAAACAAAGCCGGAAAGCCAGAAAGTTCACGGTTTCGC AATCCGCTGGTTTCAGCGAAATTTGCCGATGCCGACGAGCCCTAAgcgtcacagaacgaaaaaccga cacgggccgccggatgtggtttgaggtgtttttttcttattttgcgcaaagatagcacaggctaacccaaccttcaaggccatacctaaTTG     CT0836 Gene: CT0836     GI: 21673665     BI number: CT0836     GOG: COG4886     Description: internalin-related protei CG C  A GT TG TC TC AG |  A |  C A  G A  A        g GG       c  a CC       a  a GC       a  a |  C      g  a AT       a  a CA       c  c TA       a  c T  g       cg Tc        ta         g Gg        gc       g  a Gt       c  a      c  t Tc       g  c       cg |  a      A  |       gt C  c      A  |       cg Ga       T  |       cg Cg        Cg        gt C        Cg        gt T        Cg        gt A         Gc        cg A        A  |      a  a C         Gc       c  | G         Cg       a  | C        A  c      g  | T  |       Gc        cg T        Cg        cg T        Cg        at                         gtttttttcttattttgcgcaaagatagcacaggctaacccaaccttcaaggccatacctaaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG4886 Leucine-rich repeat (LRR) protein ... can be seen here     ..................................................................................................................