                                                                        Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:166 nt.    Distance to gene:42 nt.     Distance to run of Ts=3 nt.   Size=32 nt.     Delta G=-12.40 kcal/mol
Antiterminator:    Distance from promoter:120 nt. Size=58 nt.     Delta G=-16.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGACA-TTTGCT. It has a score value of 65.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGACATATGCGTTGCGTATGGTTTTTGCTTTGACCTGAACGGGTTTATTTGTTTTAC
CTTGATCAATTATTTTTTTTGCCAAATTCCTATTGCGTTCACTGGGCCTTTGAATGGA
CAAGGCTTTCACCTGAGAGCCGCAATACACCCCGGATGCAATCATCATagccggaaaatcagta
aaagacttttcggcttccccgtagcattgtaatcaaatgcgagtggggcgctgttttttgttacaggaaagacaatctccaagcaatttcaacaaggagt
tttttATG

    CT0847 Gene: CT0847     GI: 21673676     BI number: CT0847     GOG: COG0425     Description: conserved hypothetical protei   a t  a g  a a  a cg ta a  c at at at gt gc cg cg         a gc       a  t at       t  c T  t      g  a A  c       ta C  c       ta T  c       at A  c       cg C  |       gc Tg       |  g At       a  a A  a      t  g Cg        gt Gc        cg Ta        cg At        cg Gt        cg             cgctgttttttgttacaggaaagacaatctccaagcaatttcaacaaggagttttttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG0425 Predicted redox protein, regulator of disulfide bond formation ... can be seen here     ..................................................................................................................