                                                                        Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:71 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G= -6.30 kcal/mol
Antiterminator: Size=49 nt.     Delta G= -7.90 kcal/mol
Anti-antiterminator:   Size=46 nt.     Delta G=-10.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGTCAAGGGCAGCCAGATGGCCAACGAACGCCTCGGCAAGGTTCAGGAGACGCTCGAC
AGGCTCATGCTCGAAGCCGAGCGCGTCGAGCAGGTGCAGCTCGCCATCAACGAATGGG
ACAAGCTGCCGGGTATCCTTGAGGAGTTCTCGAAGAAGATCAAAGATATAGGTGACAA
TCCGTACAAGGGATTCTAAatcaaccaccgcggtcagcagggcaacgccgctttcttgagcgatcagggagtttgccgttctcctg
ctgtccgggtttataccgctgttaattctggaggttttctATG

    CT0867 Gene: CT0868     GI: 21673697     BI number: CT0868     GOG: COG0247     Description: heterodisulfide reductase, putativ             C           A  A           T  A           G  G   G        CG C  A       CG T  A       TA CG        AT TA        AT TA       |  C G  G      |  T A  A      |  A G  |      |  A G  |      |  a AT       |  t GC       |  c TA       |  a TA       C  a        g C  A      A  c      a  g CG        Gc        cg TA        Ta        gc AT        Gc       |  a TA        Gc       a  a GT       A  g      c  c G  A      T  c       tg G  |      A  g       gc CG        Tg        gc CG        At        cg GT        Gc        gc                         tttcttgagcgatcagggagtttgccgttctcctgctgtccgggtttataccgctgttaattctggaggttttctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG0247 Fe-S oxidoreductase ... can be seen here     ..................................................................................................................