                                                                        Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:94 nt.     Distance to run of Ts=1 nt.   Size=18 nt.     Delta G= -8.20 kcal/mol
Antiterminator: Size=43 nt.     Delta G=-11.30 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G=-15.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTCTGGCGTTTGGGGATCAGTTGCGGCTCGAAGCTGCCGTTGCGGTCGCGCGGAGAGC
GGATGGTGAACTGATCGTTATCAACGATAATGGTTTTGCTGCCGTGTCCGTTGCGGCT
GTTGCTGGTGTTGGGCACGATGGGTAGAGATGCTTTGGATAGCCGAGCTGCTCGTCCA
GCTCGCCCTGAATGTCCGGGGTCTTCTTTCTTTCTGGTCATagttttgctccttgttacatgagaggaca
ctatgaccgtttagacacggtatcttacagacccccatttttacgccgtcgcctggATG

    CT0877 Gene: CT0877     GI: 21673705     BI number: CT0877     GOG: -------     Description: hypothetical protei   A G  T       AG C  G      G  C A  G      C  T CG        CG GT        GC |  A       AT G  G      |  C G  A       TG TG        AT TA        GC GT        GC TG        TA GC        TG GT       T  | T  T      C  | C  T      G  | G  G      T  |       TG TG       A  |      A  T TA        GC       A  C GT        AT        GC TA        GC        TG CG       A  |       CG GC        TG        CG GC        GC        CG CG        GC        GT                         CTTCTTTCTTTCTGGTCATagttttgctccttgttacatgagaggacactatgaccgtttagacacggtatcttacagacccccatttttacgccgtcgcctggATG     ..................................................................................................................