                                                                        Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:40 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-17.80 kcal/mol
Antiterminator: Size=43 nt.     Delta G=-14.60 kcal/mol
Anti-antiterminator:   Size=23 nt.     Delta G=-10.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAAGGACTCAAGATCGGCGCCACCTATCAGCTCGTTCAGAACATGACGCTTGGCGCGA
CCTACTTCCACGTCAATCCGGTCGATAGCAGCCTCACCGGTTCTACAAGCGATCACAA
GAACCTGGTTCAGGCTGATGTTGCCGTGAACTTCTGAtgctgaactgctgttctttttgtgtgatgttctttc
tccgttgggtgagtgtgtggtgctcatccggattgctgcaaagccgccccgacttgtcgaggcggcttttttacggccctccactctcggcatggttgag
ccgatttccgcTTG

    CT0894 Gene: CT0894     GI: 21673722     BI number: CT0894     GOG: -------     Description: hypothetical protei             c           t  c           a  g            cg            ta           c  t           g  t            tg            gc           g  t           t  g       tt   t        gc       c  g g  g       ta        at t  g      |  a       gc g  t      g  a       cg tg        tg       c  a gc        gc        cg at       a  |       cg gc        gc        gc ta        tg        cg gt        gc        cg gc        gc        gc gc        gc        at                         tttttacggccctccactctcggcatggttgagccgatttccgcTTG     ..................................................................................................................