                                                                        Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:22 nt.     Distance to run of Ts=0 nt.   Size=17 nt.     Delta G=-10.60 kcal/mol
Antiterminator: Size=41 nt.     Delta G=-10.20 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G= -9.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGAGATGATCAAGAAAGCTGTTGAGGCCTTTGTCAGCGGCAACTCGAAACACGCCACC
GAGACGCTCGACATGATGAAAAAGATCGACGATCTTTACCAGAAAGCGGTTGCCAAGC
TCAAGGCCGAGGTCAACGACTCGAACATCATCAACTCCACCGGCATTCTCTCCGTCGT
GGAGCACGTTCACACCTGTGCTGAAATCTCCTGCGCGATCGCCCGGCACTTCTGCTGA
GTCAAAGCATTGAAAACTTTCAGAAGGCGGGCAAGTCCCGCCTTCTTTAAGCTCATGC
TCAACAGGAATTG

    CT0905 --- CT0906 --- CT0907 --- mod --- CT0909 --- CT0910 --- res Gene: CT0905     GI: 21673733     BI number: CT0905     GOG: -------     Description: hypothetical protein Gene: CT0906     GI: 21673734     BI number: CT0906     GOG: COG0553     Description: DNA-dependent ATPase, SNF2 family protein Gene: CT0907     GI: 21673735     BI number: CT0907     GOG: NOG16997     Description: hypothetical protein Gene: mod     GI: 21673736     BI number: CT0908     GOG: COG2189     Description: type III restriction system methylase Gene: CT0909     GI: 21673737     BI number: CT0909     GOG: COG4637     Description: hypothetical protein Gene: CT0910     GI: 21673738     BI number: CT0910     GOG: NOG29016     Description: hypothetical protein Gene: res     GI: 21673739     BI number: CT0911     GOG: COG3587     Description: type III restriction system endonucleas TG C  C C  G T  C CG        GC TA       A  A AT        AT |  C       AT |  G       CG A  C       TA A  C      |  A GC       |  A TG       |  A CG        GC GC        AT TA        GT GC       T  T T  T      C  | C  T       GC         A C  C       TA       A  G AT        CG       C  T CG        TA        GC |  C       TA        GC AT        CG        GC CG       A  |       CG TA        CG        GC TG        GC        GC                         TTCTTTAAGCTCATGCTCAACAGGAATTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [KL] COG0553 Superfamily II DNA/RNA helicases, SNF2 family ... can be seen here [L] COG2189 Adenine specific DNA methylase Mod ... can be seen here [R] COG4637 Predicted ATPase ... can be seen here [V] COG3587 Restriction endonuclease ... can be seen here     ..................................................................................................................