                                                                        Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:22 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-12.10 kcal/mol
Antiterminator: Size=47 nt.     Delta G=-20.60 kcal/mol
Anti-antiterminator:   Size=41 nt.     Delta G=-12.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AATGCGCCGCGTCCGGCGACCGTCGATGGGCCGATGCGCACGCTGCCACGGCAGACGT
TCTCCTGTTTGTTGCGGAAAGCGTTGACAAGAAAAGCTCCTGCTCCCGCTCCGGCGGC
GAAGATGATGGTCGCTATAAAAAAGAGAAGAGGTGTCATgcgattccagctgtcgatggaaaagctgaaaa
tacgaatctcatgattgaattcatcgggcggctgccggagcaatcaggaatgttttctccggcagatcggttcgagttggagaggtttttttcctaacca
tgtctgaaggctgGTG

    CT0953 Gene: CT0953     GI: 21673781     BI number: CT0953     GOG: COG1136     Description: ABC transporter, ATP-binding protei            ga           g  a gc        at g  t       cg cg       t  t gc        at gc        at g  g      c  t cg        gc         g ta        at       c  g a  g       gc       t  t c  |       gc        at t  |       cg        gc t  |       cg       |  g a  |       gc       a  a a  |       ta        cg gc        cg        gt ta       g  a       gt ta       g  |       cg at       c  |       cg gc       g  |       ta ta        gt        cg a  g       gc        ta cg        cg        tg ta        tg        tg                         tttttttcctaaccatgtctgaaggctgGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [V] COG1136 ABC-type antimicrobial peptide transport system, ATPase component ... can be seen here     ..................................................................................................................