                                                                        Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:17 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-30.10 kcal/mol
Antiterminator: Size=31 nt.     Delta G=-10.80 kcal/mol
Anti-antiterminator:   Size=54 nt.     Delta G=-16.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGCCTCGCTGATCGACTTCAATTACAAAATCGAGCCGTTGCCGGGCAAGTTCCCGATG
CCAAAGCTTGGGCCATTCTCACTGTTGAAGGAGACCAAGATGAACTGGTATGGCAAGC
TCGCCTTCGAGCCGCTCTACTGGAACGTCCTGCTCGATGGCAAACACCTTGGTATGCC
TCCTACCCTTGTTATGGCCGGTAAAGAGGTCGGATAAggtttttttgctgccgcagccggattttccagccgg
gggtttgttgaaaagcagactcccggctgttttttgttgtcaacgccaatcttTTG

    CT1025 Gene: CT1026     GI: 21673853     BI number: CT1026     GOG: -------     Description: hypothetical protei AT G  A G  A Cg Tg G  t G  t At Gt At At                  aa At         t       g  a Tg       t  t       ta Gc       a  t       tg Gt        gc        gc C  |       gc        ta Cg       c  a       tg Gc        cg        ta Gc        gc        gc Tg       a  |       gt A  c      c  |       gc Ta        gc        gc Tg        cg        gc Gc        cg        cg T  c      g  g       cg T  |       tg        gc Cg        cg        at Cg        gt        cg                         ttttttgttgtcaacgccaatcttTTG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_tepidum_TLS                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:81 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-12.00 kcal/mol Antiterminator: Size=41 nt.     Delta G= -8.00 kcal/mol Anti-antiterminator:   Size=39 nt.     Delta G=-14.60 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CGCCTCGCTGATCGACTTCAATTACAAAATCGAGCCGTTGCCGGGCAAGTTCCCGATG CCAAAGCTTGGGCCATTCTCACTGTTGAAGGAGACCAAGATGAACTGGTATGGCAAGC TCGCCTTCGAGCCGCTCTACTGGAACGTCCTGCTCGATGGCAAACACCTTGGTATGCC TCCTACCCTTGTTATGGCCGGTAAAGAGGTCGGATAAggtttttttgctgccgcagccggattttccagccgg gggtttgttgaaaagcagactcccggctgttttttgttgtcaacgccaatcttTTG     CT1025 Gene: CT1026     GI: 21673853     BI number: CT1026     GOG: -------     Description: hypothetical protei             C   C       C  T A  T      G  C T  G      T  C CG        AT TA        TA C  A       GC        AA GC        GC       T  A CG       T  C      G  G |  T      T  T      G  A |  C      C  |       CG |  C      C  |       CG |  T       AT        GT CG        CG        GC GC        AT        TG AT        AT       A  | GC       |  A       TG CG       |  T       TA TA       A  G       GT T  T       CG        TA CG        GC        TA CG        GC        Cg GC        TG        Cg                         tttttttgctgccgcagccggattttccagccgggggtttgttgaaaagcagactcccggctgttttttgttgtcaacgccaatcttTTG     ..................................................................................................................