                                                                        Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:107 nt.     Distance to run of Ts=3 nt.   Size=35 nt.     Delta G= -9.20 kcal/mol
Antiterminator: Size=33 nt.     Delta G=-11.20 kcal/mol
Anti-antiterminator:   Size=18 nt.     Delta G= -4.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAGCCTTCGTCGCCTCCTGTTCGTTCGCTTCGCTCACCCGTCCCCTTCCTCCTGGCTC
CATCAGTTTGCCGCCAACCAGTGGCAATTGACCTGAAGTGTAAATCAGATCGCCAATC
CGTACCGCTGGCTGGTAAAGTCCCGCTGCTGAAGGGATTTCCGGGAGAAGAATACCGG
CGTTCTTTAGATTTTCTTCATGAGATATCATgacctttttgtgttttctgtttgggaaaagagcggaaaatccgaac
agttagggatagattttccagattgcgattcctttggaaaatagttatcGTG

    CT1174 --- thiE --- thiD Gene: CT1174     GI: 21674000     BI number: CT1174     GOG: COG0352     Description: thiamine-phosphate pyrophosphorylase, putative Gene: thiE     GI: 21674001     BI number: CT1175     GOG: COG0352     Description: thiamine-phosphate pyrophosphorylase Gene: thiD     GI: 21674002     BI number: CT1176     GOG: COG0351     Description: phosphomethylpyrimidine kinas             C        AG           G  T      A  A           T  G      G  A           C  A      A  T           G  A      G  A            CG        GC            CG        GC            CG        CG            TA        CG AA        GT       T  C A  G       AT       T  | T  T       AT        TG GC       A  |       AT GC       T  |       GT T  C       GC        GC CG        GC        GT GC        TG        AT GT        CG        AT                         AGATTTTCTTCATGAGATATCATgacctttttgtgttttctgtttgggaaaagagcggaaaatccgaacagttagggatagattttccagattgcgattcctttggaaaatagttatcGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0352 Thiamine monophosphate synthase ... can be seen here [H] COG0352 Thiamine monophosphate synthase ... can be seen here [H] COG0351 Hydroxymethylpyrimidine/phosphomethylpyrimidine kinase ... can be seen here     ..................................................................................................................