                                                                        Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:82 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G= -7.00 kcal/mol
Antiterminator: Size=48 nt.     Delta G= -9.40 kcal/mol
Anti-antiterminator:   Size=54 nt.     Delta G=-10.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATACCTGGCCGCTTCAAGTTTTCTCAGGTGAATACTGAGATTTCCATCCGTAGCTCTG
ATACTGTCGCGAATGTCAACGAACGATGCTTCAGGGACGCTCATCAGATAAGCCAGTG
CTGCAAAGCGAATTCTCGCATGAATAACCTTGTCGAGAAGCTGATGATTGTAATCCTT
TTTGTCTTTCGATGGTTCCAGAGACATtctttcttttaaattatttcaacggttactaaggagacttgacgtcgtataca
aataagagtactttttttttcgatcaagagcaagcgaagcaacaaaATG

    CT1183 Gene: CT1183     GI: 21674009     BI number: CT1183     GOG: COG0820     Description: florfenicol resistance protein, putativ TA A  A A  C G  C T  T       GT AT       T  A CG        TA |  T       AT GC        GC CG       T  C TA        AT CG        GT TA       |  T TA       |  T A  |      T  T A  |       CG G  |       GT CG       A  C GC        AT        GG AT        GT       T  T |  G       AT        AT A  A       GC        GC AT        CG       C  C CG        TA        TA |  A       GT        TG G  T      T  |       TA T  T      T  |       CG CG        CG        TA GT        CG        GC TA        AT        TA                         TtctttcttttaaattatttcaacggttactaaggagacttgacgtcgtatacaaataagagtactttttttttcgatcaagagcaagcgaagcaacaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0820 Predicted Fe-S-cluster redox enzyme ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_tepidum_TLS                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:91 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G= -7.00 kcal/mol Antiterminator: Size=48 nt.     Delta G= -9.40 kcal/mol Anti-antiterminator:   Size=27 nt.     Delta G= -6.00 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ATACCTGGCCGCTTCAAGTTTTCTCAGGTGAATACTGAGATTTCCATCCGTAGCTCTG ATACTGTCGCGAATGTCAACGAACGATGCTTCAGGGACGCTCATCAGATAAGCCAGTG CTGCAAAGCGAATTCTCGCATGAATAACCTTGTCGAGAAGCTGATGATTGTAATCCTT TTTGTCTTTCGATGGTTCCAGAGACATtctttcttttaaattatttcaacggttactaaggagacttgacgtcgtataca aataagagtactttttttttcgatcaagagcaagcgaagcaacaaaATG     CT1183 Gene: CT1183     GI: 21674009     BI number: CT1183     GOG: COG0820     Description: florfenicol resistance protein, putativ            TT           A  G            GT            TA            AA           G  T            TC            CC           |  T           |  T           G  T            AT TA        AT A  A      G  G A  C       AT        GG G  C       GC       T  T T  T       CT        AT AT        TT        GC CG        GT       C  C |  T       TC        TA GC        TG        TG CG       C  |       TA TA       C  |       CG CG        AA        TA TA        AT        GC TA        TG        TA                         TtctttcttttaaattatttcaacggttactaaggagacttgacgtcgtatacaaataagagtactttttttttcgatcaagagcaagcgaagcaacaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0820 Predicted Fe-S-cluster redox enzyme ... can be seen here     ..................................................................................................................