                                                                        Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:60 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G=-10.00 kcal/mol
Antiterminator: Size=25 nt.     Delta G= -3.80 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G=-11.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCAAAACTGCCAAGCCGCGCAAAAAAGCAAGCGCCAAGCCCATGGCTCCAGAAACCCC
TGCCGCAAGCCCGGAGACAGTTGAAGAGCATATCCGGGTCGCCGCCTACTACCGCTGG
GTCGAACGAGGCATGACCGATGGAGGACATGAAGAGGACTGGATTGCAGCCGAGAAAC
AGATTAAGGGATAAtcacgttctcaaatctgacaatgaaaaaagccattcgtcgaatggcttttttatattcaggctttctccgtactcg
gccggaagtttcgtttaaccctccggccgttattcaATG

    CT1202 Gene: CT1202     GI: 21674028     BI number: CT1202     GOG: -------     Description: hypothetical protei   G G  G A  A AT TA TA At Gc A  a C  c A  g At At Gc At Gc        aa |  a      a  a |  a      a  g        t C  a      a  c      g  c C  t       gc        cg Gc        ta        ta At        at        ta Cg        at        at |  a      |  c       cg Gc        cg        cg Ta        at        gc Ta        gc        at At        tg        at                         ttttatattcaggctttctccgtactcggccggaagtttcgtttaaccctccggccgttattcaATG     ..................................................................................................................