Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:149 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-12.40 kcal/mol
Antiterminator: Size=45 nt.     Delta G=-14.56 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G=-14.32 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGCGACTGGGGGTTGAAGAACCCCGCGCCGAGCAGACGTCCGTCGTGGGTGAAGAGCT
GAACGGTTTCTCCGGCGGCAATGTCACGCGGCACCTCCCGAAGCTCGTTGCTGAAAAC
CCACAGGTGGCCGCTGACCAGCCGCCGGTGTTCTTTTGGTTTGAGGTAGAGTGAGTGC
ATggatcgaaaactcccggtttcatgttttgacagagaaatgatttaattaaaataacatttcggagctatcaaccttgaccgggattcagattcaacg
ggaagagtggttcggatggattgagctATG

    CT1212


Gene: CT1212     GI: 21674037     BI number: CT1212     GOG: -------     Description: hypothetical protei


 GT
T  C
A  A        G
A  C      C  T
 CG       T  T
 GC        CG
G  G       GC
 CG        AT
 GC       |  G
G  A      |  A
C  C      |  A
C  C      |  A
T  T      |  A
C  C      A  C        G
T  |      G  C      T  A
T  |      C  C      C  C
T  |      C  A      G  C
 GC       C  C      C  A
 GC        TA        CG
 CG        CG        GC
A  A       CG        GC
A  |       AT        TG
G  |      |  G       GC
 TA        CG        GC
 CG        GC       A  G
 GC        GC        CG
 AT        CG        AT
 GC        GC        CG
                        TTCTTTTGGTTTGAGGTAGAGTGAGTGCATggatcgaaaactcccggtttcatgttttgacagagaaatgatttaattaaaataacatttcggagctatcaaccttgaccgggattcagattcaacgggaagagtggttcggatggattgagctATG


    ..................................................................................................................