                                                                        Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:27 nt.     Distance to run of Ts=3 nt.   Size=21 nt.     Delta G= -8.50 kcal/mol
Antiterminator: Size=35 nt.     Delta G= -9.80 kcal/mol
Anti-antiterminator:   Size=20 nt.     Delta G= -7.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGGGGAGGGCCGCGAGGCTTATGGTGAGGCTGTCGAAAGCCTGCGGAAGGGAGATATG
GACAGTGCGCTCGAACATTTCATCTCGGTTCTGCGGACAAACCGCTATTACGACGACG
ATGGTTCACGCAAGGCCTGTATCGCCATTTTCCGGTTTCTCGGCGAAGAGCATGAAAT
TACGATGAAATACCGTCGAGCGTTTGACCGGGCGTTCTGAagaaaaaatcatgaatggttggccttgggc
gccagctgaattgttttccctgtcttttcctataagtcgtgtaagtcctatacgacGTG

    CT1214 Gene: CT1214     GI: 21674039     BI number: CT1214     GOG: NOG40720     Description: hypothetical protei            aa           a  a           g  a           a  a            At            Gc            Ta           |  t        g AC        Cg       t  g G  C       Ta       t  g TG        Ta       c  c TG        Gt        cg TG        Cg        gc GC       G  g       gc CG        Gt        ta GT        Gt        tg AT        Cg        gc GC        Cg        gt                         gaattgttttccctgtcttttcctataagtcgtgtaagtcctatacgacGTG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_tepidum_TLS                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:38 nt.     Distance to run of Ts=3 nt.   Size=21 nt.     Delta G= -8.50 kcal/mol Antiterminator: Size=35 nt.     Delta G= -9.80 kcal/mol Anti-antiterminator:   Size=56 nt.     Delta G=-14.00 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TGGGGAGGGCCGCGAGGCTTATGGTGAGGCTGTCGAAAGCCTGCGGAAGGGAGATATG GACAGTGCGCTCGAACATTTCATCTCGGTTCTGCGGACAAACCGCTATTACGACGACG ATGGTTCACGCAAGGCCTGTATCGCCATTTTCCGGTTTCTCGGCGAAGAGCATGAAAT TACGATGAAATACCGTCGAGCGTTTGACCGGGCGTTCTGAagaaaaaatcatgaatggttggccttgggc gccagctgaattgttttccctgtcttttcctataagtcgtgtaagtcctatacgacGTG     CT1214 Gene: CT1214     GI: 21674039     BI number: CT1214     GOG: NOG40720     Description: hypothetical protei   T A  T A  A A  C G  G TA AT CG |  A G  A A  A G  T A  A A  C       GT GC       C  T CG       G  C GT       G  T GC        GG CG        CA TA        Ca CG       |  g        g |  C       Aa       t  g |  G       Ga       t  g |  T       Ta       c  c |  T       Ta        cg T  T       Ta        gc TG       G  a       gc TA        Ct        ta GC        Gc        tg GC        Aa        gc CG        Gt        gt                         gaattgttttccctgtcttttcctataagtcgtgtaagtcctatacgacGTG     ..................................................................................................................