                                                                        Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:69 nt.     Distance to run of Ts=2 nt.   Size=36 nt.     Delta G=-19.40 kcal/mol
Antiterminator: Size=36 nt.     Delta G= -7.40 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G= -8.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGGCTCCATAAAAACAACCCGGATGTATTCAGTCTGGACTTTGTGGTTGGTCACGATG
AGGTCAGCCCAGGAAGAAAAAATGACCCCGGCGGCTCTCTTTCCATGTCGATGCCAAA
GTATCGGGAATTCCTGAAACAGCAAGCGGGGTAGattatttcctcagcaggttaaaaggctcaaacaggagaggc
tgtttctgattggcttgggagacagcctctcctgttttctcccgcaatcggacaagacacaaaaacagggccatacatttccaggcttcccgataattat
gtatcttcaGTG

    CT1226 Gene: CT1226     GI: 21674051     BI number: CT1226     GOG: -------     Description: hypothetical protei tt a  a G  t A  t T  t Gc Gc        ca Gt       a  g       gg Gc       a  g      t  c |  a      a  a      t  t Cg        cg       a  t Gc        ta       g  g A  a       cg        tg A  g      g  g       cg Cg        gc        ta Gt        at        tg At       a  g       ta C  a      a  t       gc A  a      a  t       ta A  a      t  |       cg A  |      t  |       gc G  |       gt        gc Ta        gc        at Cg        at        gc Cg        cg        at                         cctgttttctcccgcaatcggacaagacacaaaaacagggccatacatttccaggcttcccgataattatgtatcttcaGTG     ..................................................................................................................