Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:32 nt.     Distance to run of Ts=1 nt.   Size=31 nt.     Delta G= -8.90 kcal/mol
Antiterminator: Size=76 nt.     Delta G= -9.70 kcal/mol
Anti-antiterminator:   Size=29 nt.     Delta G= -6.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCCCCAGTTTACCGATCCACGCCACGGTTCGATGACCATGCAGTTCATCGAACTGGGG
GCCCTCTTCATTCTTGCCACCCTGATCGTTTTCGCCGGATTGAGTATGGTTGCCGGTG
GGCTTGGAGAGCGCTTCCGCCGTTCACCTGCCGCACTCAGATTGGTCAACCGCGCCGC
TGCCATGATTTTTACCGGACTTGCCATAAAACTGGCCATAACCGAACGCTAAataaccttc
tctcatcggtggtgattatggggggggctttttgtttttctgtacaaaaaaacgtacaataaaaaGTG

    CT1266


Gene: CT1266     GI: 21674089     BI number: CT1266     GOG: COG2161     Description: conserved hypothetical protei


           aa
          t  c
          a  c
           At
           At
           Tc
           Ct
          |  c
          G  t
          C  c
          A  a
          A  t
           Gc
           Cg
           Cg
          |  t
          |
          |
          |
          A
           A
           T
           A
           C
          |
          |          g
          |        g  t
          |        c  g
 AA       C         tg
A  A      G         at
T  C       G        cg
 AT        T        ta
 CG       C        |  t
 CG       A        |  t
 GC       A        |  a
|  C      A  |      |  t
T  A       A        cg
T  T       T        tg
C  A      A         cg
A  A       C        tg
 GC        C        tg
 GC        G        cg
 CG        T        cg
                        gctttttgtttttctgtacaaaaaaacgtacaataaaaaGTG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[D] COG2161 Antitoxin of toxin-antitoxin stability system ... can be seen here

    ..................................................................................................................