                                                                        Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:51 nt.     Distance to run of Ts=3 nt.   Size=24 nt.     Delta G= -8.70 kcal/mol
Antiterminator: Size=22 nt.     Delta G= -3.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTGTAGATGAAAATCAGTGACGTTGCCATGATGTATGCCATtgcagctgttcgctgtttcttgatctgtc
tattcgggtaacgcctgcgattgcggaaacgatccgttcaggattggctacctgtgccggtcgcgcaacgccagaaacatcgacgcaggctggccgcgcc
tcgtggttcgcatatcgaatgaaaatctctactttatgaaaatgccgtagcaaattgtgttaacggccaatctttttcctgccacggttttctgttcacg
atagttctaaacgctcttccccctatcgttATG

    CT1273 Gene: CT1273     GI: 21674096     BI number: CT1273     GOG: -------     Description: hypothetical protei             t           a  t aa       a  g g  a       at ta        cg at        gt tg        at t  c      |  a t  c       ta cg        gc at        cg ta        cg cg        gc             caatctttttcctgccacggttttctgttcacgatagttctaaacgctcttccccctatcgttATG     ..................................................................................................................