                                                                        Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:68 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-15.00 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -9.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGTCTTTTACCAGAACGACCAGCAGAAAAAAATAGCCGAGGCGCTGATCGAGCAGCTT
AAAAAACGGGGGTACGACGTGGTAACCAGTGTGGAAAAAGGGGGGGAGTTCTGGCCGG
CGGAGCTCTACCATCAGGATTATTACGAAAAGACAGGGCATAAGCCCTACTGCCATAT
TTATCAGAAGCGGTTTTAAggtgattaggggcggctcttgtggctgccctgtttttttgtgggcttgacatcccgcttttttttgt
taaattattggcatatgctaataattgctgactaaaaaaaATG

    CT1277 --- CT1276 Gene: CT1277     GI: 21674100     BI number: CT1277     GOG: COG1342     Description: conserved hypothetical protein Gene: CT1276     GI: 21674099     BI number: CT1276     GOG: COG1433     Description: conserved hypothetical protei GG C  T GT AT AT G  A A  A Cg Tg At Tg         t Ta       t  g T  t      c  t At        tg Ta        cg |  g       gc A  g       gt Cg        cg Cg        gc Gc        gc Tg        gc Cg        gt             gtttttttgtgggcttgacatcccgcttttttttgttaaattattggcatatgctaataattgctgactaaaaaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1342 Predicted DNA-binding proteins ... can be seen here [S] COG1433 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................