Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:53 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G= -8.60 kcal/mol
Antiterminator: Size=23 nt.     Delta G= -7.12 kcal/mol
Anti-antiterminator:   Size=57 nt.     Delta G=-13.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

cggaaATGATACGAAAAACTGTTAAGACCGTCGGAACGGCGTTTGTATTTTCGCCATTCG
GAATGCCGCTCCTTGTGCATGGCGCCGCCGGGCTGCTTGTTGGAGCCGTTGGTCTGAA
CCTGCTCAACGGTGTTATCAACGATGTCAAGAGCGCTGGAGACATTTTGCAAAAAGAG
ATGAGCAAACCCAGCGACCGGCAGCAGGACGAAGAGCCGGAATGAaccggttattttcttttttcag
ttttgtagtaccgtagtgcctgaaataacataaacttaaatattcagagaggttaacATG

    CT1283


Gene: CT1283     GI: 21674106     BI number: CT1283     GOG: -------     Description: hypothetical protei


  A
A  A
C  A
G  A
 TG
 TA
 TG
 TA
 AT
 CG
|  A
|  G
|  C
|  A
A  A
G  A
A  C
 GC                  TG
 GC                 A  A
 TA                 A  a
 CG         A        Gc
 GC       G  C       Gc
 CG       G  G       Cg
G  A      A  A       Cg
A  C      C  A       Gt
G  C      G  G      |  t
A  |      A  A      |  a
A  |       CG        At
 CG        GC        Gt
 TG        GC        At
 GC        CG        At
 TA        CG        Gc
                        ttttttcagttttgtagtaccgtagtgcctgaaataacataaacttaaatattcagagaggttaacATG
    ..................................................................................................................