Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:141 nt.     Distance to run of Ts=0 nt.   Size=19 nt.     Delta G=-13.30 kcal/mol
Antiterminator: Size=57 nt.     Delta G= -5.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTAAAAGAGAACACCCGTTTCGTACGCATCACCTCTGCTGGCCTCCGCGAAAGCCACC
CGCACGATGTGATGATAACCAAAGAAGCACCGAACTACTCGACCTCTGCATAAgaatccag
cacaccacactcgaaaaccccggttcaatgccggggttttctggttttggcgaaaaaagatcgccaatatctgccggatcagtctaatcggaaaaatgat
tattttgaaagaggtaacgccttttcgacgaaacagcgaaacccgttttttaccaactctctccagtcaagaagccaaatcATG

    CT1294


Gene: CT1294     GI: 21674117     BI number: CT1294     GOG: NOG04042     Description: conserved hypothetical protei


  a
g  a
A  t
A  c
T  c
A  a
 Cg
 Gc
 Ta
|  c
|  a
|  c
|  c
C  a
T  c
C  a
C  c
 At
 Gc
 Cg
 Ta
C  a        a
A  a      c  a
T  a      t  t
C  c       tg
A  c       gc
A  c       gc
 Gc        cg
 Cg        cg
 Cg        cg
 At        cg
            ttttctggttttggcgaaaaaagatcgccaatatctgccggatcagtctaatcggaaaaatgattattttgaaagaggtaacgccttttcgacgaaacagcgaaacccgttttttaccaactctctccagtcaagaagccaaatcATG


    ..................................................................................................................