Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:147 nt.     Distance to run of Ts=2 nt.   Size=19 nt.     Delta G= -9.80 kcal/mol
Antiterminator: Size=48 nt.     Delta G= -9.89 kcal/mol
Anti-antiterminator:   Size=67 nt.     Delta G=-17.97 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGTTACGGCATCAAAATTACCCTGCTCGACTCGACCAAAAATCTCTGGTCACTTGAAT
ATCATCGCCAGATGATCTGAacccccaagacggtcgagcactcccgttttttattctcttttcagcggggctttaccgctgcatc
tttttcttttcaacATGGTATCTCCGTTTTTGCGCCGCGAAAAAAATTTTTTGATGAACGCAGG
AATCGGTGGGGTGGCGTCGTCCTATGGGGTGAAAAAGGATCCCTATTGAtgaattcaggcgcct
cgaatacaaaagcaaacgaaagtaaaacgATG

    CT1309


Gene: CT1309     GI: 21674132     BI number: CT1309     GOG: -------     Description: hypothetical protei


 CC
G  A
 CG
 TA
 AT        ca
 CG       g  c
 TA        at
 AT        gc
T  C      c  |
A  T      t  |
A  G       gc
G  A       gc
T  a       cg
T  c       at
C  c       gt
A  c       at
C  |       at
T  |      |  t
 Gc       |  t
 Gc       |  a
 Ta       |  t
C  |      |  t
 Ta       |  c
 Cg       |  t
 Ta       |  c
A  c      |  t
A  |      |  t
A  |      |  t        t
A  |      |  t      c  t
A  |      |  c      g  t
 Cg       |  a      g  a
 Cg       |  g       gc
 At       |  c       gc
 Gc        cg        cg
 Cg        cg        gc
 Ta        cg        at
 Cg        cg        cg
                        catctttttcttttcaacATGGTATCTCCGTTTTTGCGCCGCGAAAAAAATTTTTTGATGAACGCAGGAATCGGTGGGGTGGCGTCGTCCTATGGGGTGAAAAAGGATCCCTATTGAtgaattcaggcgcctcgaatacaaaagcaaacgaaagtaaaacgATG


    ..................................................................................................................