Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:58 nt.    Distance to gene:30 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-10.31 kcal/mol
Antiterminator:    Distance from promoter:30 nt. Size=46 nt.     Delta G= -6.61 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTCACT-AAAAAC. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTCACTCTCGCTCTCGATTCCTGAAAAACCGGTGCAGTTTTTGCGCACAAGCTCCCTT
CCTCCATCCCCCACATATTTTTCCCCTAACCGGTTGTGAGTCTGGAGACAGACCGGTA
TTTTCAAgctttactcctgaaccacggtcacgATG

    CT1344 --- ddlA --- CT1346


Gene: CT1344     GI: 21674166     BI number: CT1344     GOG: COG1832     Description: conserved hypothetical protein
Gene: ddlA     GI: 21674167     BI number: CT1345     GOG: COG1181     Description: D-alanine-D-alanine ligase A
Gene: CT1346     GI: 21674168     BI number: CT1346     GOG: -------     Description: hypothetical protei


  C
C  C
C  T
T  A
T  A
T  C
T  C
T  G       AG
A  G      G  A
T  T       GC
 AT        TA
 CG        CG
 AT        TA
 CG       G  |
C  A      A  |
C  G      G  |
C  T      T  |
C  C      G  |
T  |      T  |
 AT       T  |
 CG        GC
 CG        GC
 TA        CG
 CG        CG
            TATTTTCAAgctttactcctgaaccacggtcacgATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[R] COG1832 Predicted CoA-binding protein ... can be seen here
[M] COG1181 D-alanine-D-alanine ligase and related ATP-grasp enzymes ... can be seen here

    ..................................................................................................................