Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:143 nt.     Distance to run of Ts=2 nt.   Size=25 nt.     Delta G= -7.90 kcal/mol
Antiterminator: Size=72 nt.     Delta G=-11.52 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ggtttggggttcaaaaaaaatatcatgtgctattgctatcagattagccgcaaccgatactgaatgaccagatgcgtctcttgagcaaatttatgaaaag
taatgctattcttcgtatgaagggttccctcaatgccgaaaagggggaaaattatttgccggaatccggggttgtcagtacaggattggctcatctgttc
atgttctcctcaaatccggtgatggcatcgtttttggggactccttgcgaaacacgataacggtgagttggagttgtaacccatttcacgacaaatatct
ATG

    CT1352


Gene: CT1352     GI: 21674174     BI number: CT1352     GOG: -------     Description: hypothetical protei



  a
a  a
g  a
 tg
 at
 ta
 ta
t  |
a  |
a  |
 at
 cg
 gc
 at
g  a
t  t
t  t
c  c
t  t
c  t
t  |
 gc
 cg
 gt
 ta
 at
|  g
|  a        c
g  a      c  g
a  g      g  a
 cg       t  a
 cg       a  a
 at       a  a
 gt        cg
|  c       tg
t  c       cg
a  c       cg
 at        cg
 gc        ta
 ta        ta
            aattatttgccggaatccggggttgtcagtacaggattggctcatctgttcatgttctcctcaaatccggtgatggcatcgtttttggggactccttgcgaaacacgataacggtgagttggagttgtaacccatttcacgacaaatatctATG


    ..................................................................................................................