Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:105 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G= -9.00 kcal/mol
Antiterminator: Size=36 nt.     Delta G= -6.73 kcal/mol
Anti-antiterminator:   Size=59 nt.     Delta G=-11.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTTTGGCGTAAGCTTCGAGGACGAACTGCTGCGCGTGACGATCCACTCCGCACTGCAC
CTCATGGGCTACGACGACGAAACTAGTGAACTGCGAGCAGCGATGAGCCTTCGGGAGG
ATCACTATCTTTATCGCCTCAGGCACTGAtatttccctgtcgttcgacacctgatcgttgtatcggggatagaattttt
tactaaattatcctcataaaatccccgcatttagttccctgcgccgttcagctcaccgttgatggcgatgcgcggaggctctgctaatgaaaaattttta
cggcaATG

   ق


Gene: csmI     GI: 21674204     BI number: CT1382     GOG: -------     Description: chlorosome envelope protein


  C
T  A
 CG
 CG
 GC
C  A
T  C
A  T
T  |
T  |       tt
T  |      g  c
 CG        cg
 TA        ta
 At        gc
 Ta        ta
C  t      c  |
A  |      c  |
C  |      c  |       tt
T  |      t  |      g  g
 At       t  |      c  t
 Gt       t  |       ta
 Gc       a  |       at
A  |      t  |       gc
 Gc       A  |       tg
 Gc       G  |       cg
 Gt       T  |       cg
 Cg       C  |      a  g
T  t      A  |      c  a
T  c      C  |      a  t
C  |       Gc       g  a
 Cg        Gc        cg
 Gt        At        ta
 At        Cg        ta
 Gc        Ta        gt
                        tttttactaaattatcctcataaaatccccgcatttagttccctgcgccgttcagctcaccgttgatggcgatgcgcggaggctctgctaatgaaaaatttttacggcaATG


    ..................................................................................................................