                                                                        Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:140 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G= -9.50 kcal/mol
Antiterminator: Size=46 nt.     Delta G=-24.00 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G=-20.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAAGGCTGACGACCTCAGCGGTGGCCACGAAGGTGAACGGCGTGGTGAGCACCGCGTC
TCCGGGGCCGATGCCCTTGGCCATAAGCGGAATGAGCAGCGCGTCGGTGCCGGAGGCG
CACGAAACACAGTGCTTCGTGCCGACGTACTCGGCAAGCTTTTTCTCGGCTTCGAGCA
CTTCGGGACCCATGACGAACTGGGCGCTGTCGATGATCCGCTCGATACGCTTCATGAG
GTTCTCGCGGATGCGGTTTTTCTGGGTTATGAGGTCGATGAACTGCATaattttattgggctaa
gatgATG

    CT1478 --- mpl Gene: CT1478     GI: 21674298     BI number: CT1478     GOG: -------     Description: hypothetical protein Gene: mpl     GI: 21674299     BI number: CT1479     GOG: COG0773     Description: UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligas   C G  G A  G       AA A  A      A  C TA       G  A AT       C  C CG       A  A |  A       CG CG        GT GC        CG G  |       GC T  |       GT         T TA        AT       G  A CG        GC       C  C C  C      G  |       AT CG       C  |       GC GC        CG        CG TG        GT        CG AT        TG        GC GC        GC        TA CG        GC       G  | CG        CG       C  | GT        TA       T  | G  G       GC        TA GC        CG        CG GC        GT        GC                         TTTTTCTCGGCTTCGAGCACTTCGGGACCCATGACGAACTGGGCGCTGTCGATGATCCGCTCGATACGCTTCATGAGGTTCTCGCGGATGCGGTTTTTCTGGGTTATGAGGTCGATGAACTGCATaattttattgggctaagatgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG0773 UDP-N-acetylmuramate-alanine ligase ... can be seen here     ..................................................................................................................