                                                                        Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:95 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-10.80 kcal/mol
Antiterminator: Size=38 nt.     Delta G= -9.70 kcal/mol
Anti-antiterminator:   Size=36 nt.     Delta G= -8.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGGTTATACTGATCCTGTTTGGCGGCCAGAAAATTCCGGAACTGGCCAGAGGTCTTGG
CAAGGGCATCAAGGAGTTCAAGAAAGCGCAGGCCGATATCGAGTCGGAGTTTCACAAA
GCGGTCGATGGCGTTTCAGATACGGTCAAGCAGGCCGGAAGTTCAGAGAAGAAGTCCT
GAtccgtaacggcttgctcgtcgggattttttcgttactggatgaagctgtattttcgttacactatttgaggacgaaagtacgccatgtgccggagcg
ctgtacggcaacaagaaaaaaatcagtATG

    CT1515 Gene: CT1515     GI: 21674335     BI number: CT1515     GOG: NOG16798     Description: hypothetical protei             A   A       G  A C  G      A  G T  A       AT T  T       GC TA       A  |       gg GC        GC       c  c |  G       AT        at CG        CG        at GT        TA        tg GC       |  t       gc TA       |  c      c  t |  A      T  c      c  c |  G      G  g       tg A  C      A  t       At G  A      A  a       Gc CG       G  a       Tg TG        Gc        Cg GC        Cg        Cg GC        Cg        Ta CG        Gc        Gt                         tttttcgttactggatgaagctgtattttcgttacactatttgaggacgaaagtacgccatgtgccggagcgctgtacggcaacaagaaaaaaatcagtATG     ..................................................................................................................