Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:67 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G=-14.00 kcal/mol
Antiterminator: Size=57 nt.     Delta G= -6.60 kcal/mol
Anti-antiterminator:   Size=34 nt.     Delta G= -7.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTGGTGATGAACGAGCTCGACCGCTTCCACCTGGTAGCCGACGTAGCCAACCGCGTGG
AGAGCCTCAGGCCACAAGCTGCCTACATCAAACAATACGTCCGCGACCGCCTGATCGA
GCACAAGGAGTACATCACGAAATATGGCGAGGATATGCCGGAAGTGAGGGATTGGCGC
TGGGAGGATTGAtttgatgtgatatgaaaagaaaagcggcctttgacaggccgctttttgtgttggaggtagggagagtcagattgtcagc
ttaacctgttttgccaatatcttggttctcgatgcATG

    CT1523


Gene: CT1523     GI: 21674343     BI number: CT1523     GOG: -------     Description: hypothetical protei


           at
          g  g
          t  t
           tg
           ta
           At
          |  a
          G  t
          T  g
          T  a
          A  a
          G  a
          G  a
 AG       A  g
A  T      G  a
G  G      G  a
G  A      G  a
 CG        Ta
 CG        Cg
G  G       Gc
T  |       Cg         g
A  |      G  g      t  a
 TA       G  |      t  c
 AT       T  |       ta
 GT       T  |       cg
G  G      A  |       cg
A  G       Gc        gc
 GC        Gc        gc
 CG        Gt        cg
 GC        At        gc
 GT        Gt        at
                        ttttgtgttggaggtagggagagtcagattgtcagcttaacctgttttgccaatatcttggttctcgatgcATG


    ..................................................................................................................